Den svenske chlamydiavarianten nvC trachomatis i Norge

Aktuelt
    ()

    sporsmal_grey_rgb
    Abstract
    Bakgrunn.

    Bakgrunn.

    En variant av Chlamydia trachomatis (nvC trachomatis) har skapt problemer for chlamydiadiagnostikken i Sverige. Andelen nvC trachomatis i Sverige i 2006–07 var fylkesvis 25–80 % av dem som var smittet av C trachomatis. Vårt formål har vært å overvåke nvC trachomatis blant våre pasienter fra januar 2007 frem til juli 2008.

    Materiale og metode.

    Materiale og metode.

    1.1. 2007–30.6. 2008 ble alle chlamydiaprøver ved Fürst Medisinsk Laboratorium dobbeltanalysert. Deteksjon av C trachomatis ble utført på isolert DNA med Cobas TaqMan 48 (Roche Diagnostics). Deteksjon og verifikasjon av nvC trachomatis ble utført med egenutviklede sanntid polymerasekjedereaksjonsmetoder.

    Resultater.

    Resultater.

    61 av 23 726 pasienter ble identifisert som bærere av nvC trachomatis. Andelen C trachomatis-bærere som var nvC trachomatis-positive økte fra 1,0 % i første kvartal 2007 til 3,2 % i andre kvartal 2008.

    Fortolkning.

    Fortolkning.

    Våre resultater viser en langsom, men jevn økning i andelen nvC trachomatis-positive prøver. Sammenliknet med tidligere prevalenstall rapportert i Sverige (25–80 %), er forekomsten av nvC trachomatis lav i våre data. Epidemiologien til nvC trachomatis bidrar til kunnskapen om spredning av seksuelt overførbare infeksjoner og understreker at man finner bare det man leter etter.

    Abstract

    Background.

    A mutant Chlamydia trachomatis variant (nvC trachomatis) has made it more difficult to diagnose chlamydia in Sweden. The proportion of nvC trachomatis has varied between Swedish counties (25–80 %) in the period 2006–07. Our goal has been to monitor nvC trachomatis among our patients from January 2007 and up to July 2008.

    Material and methods.

    In this time period, all C trachomatis samples at Fürst Medical Laboratory, Norway were analyzed twice. Cobas TaqMan 48 (Roche Diagnostics) was used to detect C trachomatis in isolated DNA and real-time PCR methods developed by us were used to both detect and verify nvC trachomatis.

    Results.

    61 patients of 23 726 patients were identified as carriers of nvC trachomatis. The proportion of C trachomatis carriers who were positive for nvC trachomatis increased from 1.0 % in the first quarter of 2007 to 3.2 % in the second quarter of 2008.

    Interpretation.

    Our results show a slow but steady increase in the proportion of nvC trachomatis positive tests. As compared to previous rates reported in Sweden (25–80 %), the occurrence of nvC trachomatis in our data is low. The epidemiology of this chlamydia mutant contributes to the understanding of mechanisms for spread of sexually transmitted infections and emphasize that you only find what you are looking for.

    Artikkel

    Genital Chlamydia trachomatis-infeksjon er den vanligste seksuelt overførbare bakterieinfeksjonen i Skandinavia. Ubehandlet kan infeksjonen føre til bekkeninfeksjon med økt risiko for kroniske bekkensmerter, ekstrauterin graviditet og infertilitet (1). Andelen positive C trachomatis-analyser i Europa har vært jevnt økende siden 1995 (2). Unntaket er i Sverige, der det var en uventet nedgang i antall positive i siste halvdel av 2006. Nedgangen ble etter hvert forklart med metodeproblemer som ga en høy andel falskt negative C trachomatis-analysesvar (3). Diagnostikkproblemene var forårsaket av en C trachomatis-variant, som fikk navnet «new variant» (nvC trachomatis) og som også går under navnet «Swedish variant». nvC trachomatis har en delesjon i sitt kryptiske plasmid. Dette plasmidet finnes i nær sagt alle C trachomatis-bakterier, i opptil ti kopier per celle, og er derfor et foretrukket mål for diagnostiske tester. Delesjonen i nvC trachomatis fjernet målområdet for laboratorietestene fra Roche Diagnostics og Abbott. I Sverige ga denne delesjonen spesielt store utslag i diagnostikken da testene fra Roche Diagnostics dominerte på laboratoriene. Overvåking av nvC trachomatis i Sverige viste at omfanget av mutanten varierte fra 25 % i Malmö opp til 80 % i Falun (4).

    I Norge studerte vi forekomsten av nvC trachomatis i perioden 29.11. 2006–9.2. 2007 og fant at denne var svært lav, under 0,5 % (5). Dette, kombinert med at C trachomatis-testene fra Roche Diagnostics ikke har vært like utbredt i Norge som i Sverige, førte til at den nasjonale overvåkingen av nvC trachomatis i Norge i stor grad har vært begrenset til vår analyseaktivitet på Fürst Medisinsk Laboratorium. Vi har analysert C trachomatis-prøver med en egenutviklet test i tillegg til rutinetest fra Roche Diagnostics. Begrunnelsen for dobbeltanalyseringen har vært å sikre seg mot falskt negative analysesvar, men dette arbeidet har samtidig gitt verdifulle epidemiologiske data rundt nvC trachomatis.

    I denne artikkelen presenterer vi data fra dobbeltanalyseringen. Roche har nå modifisert metoden sin, og fra og med juli/august 2008 vil ikke analyser fra Roche Diagnostics gi falskt negative svar grunnet nvC trachomatis.

    Materiale og metode

    Materiale og metode

    Studien sammenfatter analysesvar fra vårt laboratorium i perioden 1.1. 2007–30.6. 2008 og inkluderer alle pasientprøver der undersøkelse for C trachomatis var rekvirert. Eksklusjonskriterier ble ikke definert. Deler av materialet (frem til 9.2. 2007) er tidligere publisert i (5).

    Laboratoriemetoder

    Laboratoriemetoder

    Laboratorieanalyse av urinprøver ble utført ved å samle de første 5–10 ml. DNA ble isolert med instrumentet MagNA Pure (Roche Diagnostics, Mannheim, Tyskland) fra 200  µl urin. Elueringsvolumet var 100 µl. Deteksjon av C trachomatis ble utført på 25 µl av isolert DNA med Cobas TaqMan 48 (Roche Diagnostics). Deteksjon av nvC trachomatis ble utført med egenutviklet metode på 10 µl av isolert DNA på et 7 500 sanntid polymerasekjedereaksjons (PCR)-instrument (Applied Biosystems, Foster City, California) med primere og prober rettet mot både det kryptiske plasmidet og bakteriegenomet som beskrevet i tidligere artikkel med tilhørende referanser (5). Der hvor analysen var negativ på TaqMan 48, men positiv på egenutviklet metode, ble ytterligere en sanntid PCR utført for å verifisere tilstedeværelse av nvC trachomatis ved bruk av primerne «CtCpDel-FAMP1 (CGATTTCTAAGCAGGAATGGA)», «CtCpDel-RAMP1 (TTTTTCTGGCAACAGAATATGAA)» og proben «CtCpDel-Probe1 (FAM-CTCTTCCCCAGAACAAACGGATCC-TAMRA)». Verifiseringsanalysen ble validert mot DNA-sekvensering av PCR-produktet. Alle oligonukleotidprimere, TaqMan-prober og sanntid PCR Master Mix ble kjøpt fra Applied Biosystems. Avidentifiserte pasientdata ble overført til både Microsoft Excel og SPSS og analysert.

    Resultater

    Resultater

    Vi undersøkte til sammen 23 726 pasienter for C trachomatis- og nvC trachomatis-infeksjon i perioden f.o.m. januar 2007 t.o.m. juni 2008. Totalt 54 % var menn. Median alder for de med positivt analysesvar var 25 år. I undergruppen med positivt nvC trachomatis-analysesvar var det tilsvarende fordeling av kvinner og menn, og median alder var 24 år. 11,2 % av prøvene var positive for C trachomatis. 61 ble identifisert med nvC trachomatis, 2,3 % av totalantallet positive i perioden. Andelen av positive prøver med nvC trachomatis økte fra 1,0 % i første kvartal 2007 til 3,2 % i andre kvartal 2008 (fig 1).

    Diskusjon

    Diskusjon

    Andelen som testet positivt på C trachomatis er betydelig høyere enn i normalbefolkningen (6). Det skyldes i hovedsak at vi mottar en stor andel av prøvene våre fra Olafiaklinikken som blir aktivt oppsøkt av en selektert gruppe pasienter. Fra Olafiaklinikken mottar vi i tillegg kun prøver fra de pasientene som har vært til konsultasjon hos lege. Pasientene er derfor selektert på grunnlag av symptomer på, eller mistanke om, seksuelt overførbar infeksjon, noe som forklarer den høye andelen som var positiv. Denne høye andelen er i våre øyne et godt utgangspunkt for å studere forekomsten av nvC trachomatis.

    I Norge har C trachomatis-analyser fra Roche Diagnostics mindre utbredelse enn i Sverige. Mange laboratorier bruker en analysemetode fra Becton, Dickinson and Company (Franklin Lakes, New Jersey), og denne analyseplattformen har ikke vært berørt av nvC trachomatis-problematikken. Dette er kanskje hovedgrunnen til at man ikke har sett behovet for omfattende overvåking av nvC trachomatis i Norge. Dessuten har man antatt at forekomsten her i Norge har vært lav basert på vår publikasjon tidlig i 2007 (5). Likevel fantes det en klar risiko for å få falskt negative analysesvar for alle laboratorier som brukte analyser fra Roche Diagnostics, og dette var bakgrunnen for at vi bestemte oss for å dobbeltanalysere alle våre C trachomatis-prøver. Så vidt vi vet var vi det eneste norske laboratoriet som valgte å gjøre dette. Den lave, men likevel jevnt økende andelen av nvC trachomatis-positive prøver indikerer at det er en liten, men ikke ubetydelig risiko for at det kan ha forekommet falskt negative analysesvar fra laboratorier som i denne perioden benyttet analyser fra Roche Diagnostics alene. Vi understreker imidlertid at siden Roche nå har modifisert metoden sin, vil ikke lenger analyser fra Roche Diagnostics gi falskt negative svar grunnet nvC trachomatis.

    Vi fant en andel positive på 1–3,2 %, noe som tyder på en langsom økning. Dette synes naturlig, da det i Sverige rapporteres at nvC trachomatis fremdeles utgjør opp mot 40 % av de som tester positivt (7). Sammenliknet både med nåværende prevalens og med tidligere prevalenstall på 25–80 %, er andelen i vårt opptaksområde liten. I tillegg har vi mottatt prøver der pasienten ikke har hatt norsk personnummer. Dersom det finnes svensker blant disse pasientene, noe vi mener er sannsynlig, kan man ikke med sikkerhet vite om pasienten er smittet i Sverige eller i Norge. Våre rapporterte tall er derfor ikke nødvendigvis en nøyaktig beskrivelse av smitteoverføring til nordmenn. Prevalensen av smittede nordmenn er antakeligvis lavere enn 3,2 %. Den samme begrensede spredningen er blitt observert i Danmark (8), og nvC trachomatis er ikke blitt funnet i Irland (9), Nederland (10) eller Frankrike (11). En grunn til denne begrensede spredningen kan muligens være at risikopersoner i Sverige i stor grad finner sexpartnere i sitt nabolag (12). Eller kanskje kan det skyldes at personer med sexpartnere i mange land som ellers ville bidratt til spredning, hittil ikke har vært smittet av nvC trachomatis.

    Epidemiologisk er den begrensede spredningen av nvC trachomatis et lite mysterium. nvC trachomatis ble oppdaget på grunnlag av en uforklarlig nedgang i antall C trachomatis-tilfeller i Sverige. Dette viser at epidemiologisk overvåking er viktig – og at man finner bare det man leter etter. Denne historien viser også at en diagnostisk test må være robust, gjerne treffe flere målsekvenser i den patogene mikroorganismen og samtidig reevalueres jevnlig.

    Oppgitte interessekonflikter:

    Ingen

    PDF
    Skriv ut

    Anbefalte artikler

    Laget av Ramsalt med Ramsalt Media